1. Home
  2. Shop
  3. Cardiomyocytes
  4. iPSC-derived Striatal Neurons

Human iPSC-derived Striatal Neurons

iPSC-derived Striatal Neurons

The human striatum receives dopaminergic and glutamatergic inputs from different parts of the central nervous system, and is the primary input nucleus of the basal ganglia. The striatum plays key roles in coordinating various brain functions, including motivation and motor planning.

The vast majority of human striatal neurons are γ-amino butyric acid (GABAergic) projection medium spiny neurons (MSNs). These cells typically express dopamine- and cAMP-regulated phosphoprotein – DARPP32. It is these cells that specifically degenerate in the early phase of Huntington’s disease (HD) causing progressive loss of the patients’ motor and cognitive functions.

Axol has developed a medium formulation that can efficiently drive the differentiation of iPSC-derived neural stem cells to striatal neuronal lineage. The neurons derived using the medium kit are functionally active and express key markers of human MSNs, such as DARPP32, CTIP2, CALBINDIN and GABA.

By using Axol’s striatal neuron medium kit with Huntington’s disease patient-derived NSCs (ax0211), researchers can build their in vitro HD models with the disease relevant cell type (MSNs) and a real patient genetic background (with 50 GAC repeats).

Products

Human iPSC-derived neural stem cells from healthy donors

Characterisation

Phase contrast

Day 1

Day 22

Day 7

Day 28

Day 15

Day 33

Phase contrast images of Axol Human iPSC-derived Striatal Neurons from 1 day post thawing. Ax0015 NSCs were seeded at 10,000 cells per cm2 (relatively low density for later ICC imaging purpose). These images provide an overview of the health status during striatal differentiation. All images were acquired using the EVOS microscopy using 10X magnification.

Validation of key marker expression by immunocytochemistry

ICC images of differentiating striatal neural culture. Cells were fixed and stained on day 10day 18 and day 33 for markers of striatal neurons (medium spiny neurons): DARPP32, CTIP2, CALBINDIN, GABA and MAP2. Download PDF file showing additional ICC images.

Transfection

Quantitative real time PCR analyses of key marker expression levels

Q-PCR analyses of MAP2, CALBINDIN, DARPP-32 and CTIP2 expression levels in Day 33 culture of differentiated striatal neurons. The starting NSC population was seeded at 35,000 cells/cm2 on Day 1. On Day 33, Cells were pelleted, lysed and mRNA were isolated and reverse transcribed to cDNA before Q-PCR reactions. Primer sequences used:

hCalbindin_F TGTGCGAGAAGAATAAACAGGT
hCalbindin_R TAAGAGCAAGATCCGTTCGG
hCalbindin_R TAAGAGCAAGATCCGTTCGG
hCTIP2_R ATGAGTGAGGGTGGGAGGAG
hDARPP32_F GAGATGGAGGCTCTGAGGAC
hDARPP32_R GGAAGGGCGCTGAGGTTCCT
hMAP2_F CGAAGCGCCAATGGATTCCC
hMAP2_R TGAACTATCCTTGCAGACACCT

Lactate Dehydrogenase (LDH) Cytotoxicity Assay

Significant increase in HD Striatal neuron cytotoxicity

Both iPSC-NSCs (ax0015 and ax0211) were seeded at 35,000 cells/cm2 and differentiated to striatal neurons in 96-well plate for 33 days. Cytotoxicity was measured based on LDH (lactate dehydrogenase) release. LDH activity was determined by spectrophotometric absorbance at 490 nm; n=3 (3 wells per condition), along with negative and spontaneous LDH release controls

Kit used: Pierce LDH Cytotoxicity Assay Kit. ThermoFisher Cat. No. 88953

Absorbance normalized to the total protein concentration

The absorbance was normalised to the protein concentration post lysis (protein concentration was determined using Qubit 2). Normalisation did not change the results since the protein concentration of all samples were comparable.

Electrophysiological characterisation using multi-electrode arrays

iPSC-derived NSCs (ax0016) were differentiated to striatal neurons using Axol Striatal Neuron Medium Kit on a 24-well multi-electrode array plate (AlphaMed Scientific Inc.) and spontaneous action potential recordings were carried out and analysed using MED64 Presto system.

Spontaneous field action potential (n=5927)

Average Field Potential Duration:  3.66 ms

Average First Peak Amplitude: -16.69 uV

Average Second Peak Amplitude: 9.05 uV

60 second MEA recording

No. of bursts: 913; Burst rate: 1.52 Hz; Mean IntraBurst Interval: 34.96 ms

Frequency – Spike Rate within bursts: 420 Hz; Inter-Burst Interval (time between bursts): 527 ms

Burst First Peak Amplitude within bursts: -16.07 uV

Burst Second Peak Amplitude within bursts: 9.14 uV

Menu